Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTCCTGCCGTGACAAGCGCGTGCGC[A/G]TCATCGAGCCCCGCAAAGGCACTGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 605000 MIM: 615822 | ||||||||||||||||||||
Literature Links: |
BOLA2B PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
BOLA2B - bolA family member 2B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CORO1A - coronin 1A | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001193333.2 | 1039 | Missense Mutation | ATC,GTC | I,V 202 | NP_001180262.1 | |
NM_007074.3 | 1039 | Missense Mutation | ATC,GTC | I,V 202 | NP_009005.1 | |
XM_011545714.2 | 1039 | Missense Mutation | ATC,GTC | I,V 202 | XP_011544016.1 | |
XM_017022885.1 | 1039 | Missense Mutation | ATC,GTC | I,V 202 | XP_016878374.1 | |
XM_017022886.1 | 1039 | Missense Mutation | ATC,GTC | I,V 202 | XP_016878375.1 |
SLX1A - SLX1 homolog A, structure-specific endonuclease subunit | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLX1A-SULT1A3 - SLX1A-SULT1A3 readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |