Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGCCCTAGTGGCCTATGTCCCTTGC[C/T]CGGGGCCATGGAGACACTGCGGCCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 600999 MIM: 605088 MIM: 612033 MIM: 614386 | ||||||||||||||||||||
Literature Links: |
MAZ PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MAZ - MYC associated zinc finger protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MVP - major vault protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PAGR1 - PAXIP1 associated glutamate rich protein 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_024516.3 | 331 | Silent Mutation | GCC,GCT | A,A 4 | NP_078792.1 |
PRRT2 - proline rich transmembrane protein 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001256442.1 | 331 | Intron | NP_001243371.1 | |||
NM_001256443.1 | 331 | Intron | NP_001243372.1 | |||
NM_145239.2 | 331 | Intron | NP_660282.2 | |||
XM_011545715.2 | 331 | Intron | XP_011544017.1 | |||
XM_011545716.2 | 331 | Intron | XP_011544018.1 | |||
XM_017022887.1 | 331 | Intron | XP_016878376.1 | |||
XM_017022888.1 | 331 | Intron | XP_016878377.1 | |||
XM_017022889.1 | 331 | Intron | XP_016878378.1 |