Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCGGACGTTGTCCTCGTGGTCACAC[A/G]TCCCGTCTTGGGTGTGGATGGAGGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 605268 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
JPH3 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
JPH3 - junctophilin 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001271604.2 | 2842 | Intron | NP_001258533.1 | |||
NM_001271605.1 | 2842 | Intron | NP_001258534.1 | |||
NM_020655.3 | 2842 | UTR 3 | NP_065706.2 | |||
XM_017023483.1 | 2842 | Intron | XP_016878972.1 | |||
XM_017023484.1 | 2842 | Intron | XP_016878973.1 |
KLHDC4 - kelch domain containing 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001184854.1 | 2842 | Intron | NP_001171783.1 | |||
NM_001184856.1 | 2842 | Intron | NP_001171785.1 | |||
NM_017566.3 | 2842 | Intron | NP_060036.2 | |||
XM_005255994.3 | 2842 | Intron | XP_005256051.1 | |||
XM_005255999.1 | 2842 | Intron | XP_005256056.1 | |||
XM_006721201.1 | 2842 | Intron | XP_006721264.1 | |||
XM_006721202.1 | 2842 | Intron | XP_006721265.1 | |||
XM_006721203.2 | 2842 | Intron | XP_006721266.1 | |||
XM_006721204.3 | 2842 | Intron | XP_006721267.1 | |||
XM_017023344.1 | 2842 | Intron | XP_016878833.1 | |||
XM_017023345.1 | 2842 | Intron | XP_016878834.1 |
LOC100129215 - uncharacterized LOC100129215 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC105371397 - uncharacterized LOC105371397 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |