Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AATCTTTTGAGTGTTTACTGGGCCT[A/G]AATTCAAATATTGGAATAAGAGACC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 612147 MIM: 607213 MIM: 601501 | ||||||||||||||||||||
Literature Links: |
MYLK3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MYLK3 - myosin light chain kinase 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ORC6 - origin recognition complex subunit 6 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_014321.3 | 326 | Silent Mutation | CTA,CTG | L,L 92 | NP_055136.1 | |
XM_011522978.2 | 326 | Silent Mutation | CTA,CTG | L,L 92 | XP_011521280.1 |
VPS35 - VPS35 retromer complex component | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |