Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCTGGTGGCTGTGCACCTCTTTGCA[C/T]TCATGGTCTCCACGTGTCTGCTGCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 609085 MIM: 610930 MIM: 611052 | ||||||||||||||||||||
Literature Links: |
FBXL19 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FBXL19 - F-box and leucine rich repeat protein 19 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ORAI3 - ORAI calcium release-activated calcium modulator 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_152288.2 | 543 | Missense Mutation | CTC,TTC | L,F 113 | NP_689501.1 |
SETD1A - SET domain containing 1A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |