Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGGAGTTGGGCTGCAGGGCATGCAG[A/C]TGGTACACCGTGAGGCAGAGCTTGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 610660 MIM: 614574 MIM: 611562 | ||||||||||||||||||||
Literature Links: |
GLYR1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GLYR1 - glyoxylate reductase 1 homolog | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ROGDI - rogdi homolog | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_024589.2 | 994 | Missense Mutation | CAG,CAT | Q,H 205 | NP_078865.1 | |
XM_006720947.3 | 994 | Missense Mutation | CAG,CAT | Q,H 205 | XP_006721010.1 | |
XM_006720948.3 | 994 | Missense Mutation | CAG,CAT | Q,H 115 | XP_006721011.1 |
SEPT12 - septin 12 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SMIM22 - small integral membrane protein 22 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |