Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGGCTTCATCTGGATTCTCAAACTC[A/T]ACGTACGCATAGCCTTTGGACAGAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606447 | ||||||||||||||||||||
Literature Links: |
LOC106660606 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC106660606 - uncharacterized LOC106660606 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR3677 - microRNA 3677 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR940 - microRNA 940 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RNPS1 - RNA binding protein with serine rich domain 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001286625.1 | 1099 | Intron | NP_001273554.1 | |||
NM_001286626.1 | 1099 | Silent Mutation | GTA,GTT | V,V 185 | NP_001273555.1 | |
NM_001286627.1 | 1099 | Silent Mutation | GTA,GTT | V,V 185 | NP_001273556.1 | |
NM_006711.4 | 1099 | Intron | NP_006702.1 | |||
NM_080594.3 | 1099 | Silent Mutation | GTA,GTT | V,V 208 | NP_542161.1 | |
XM_005255048.1 | 1099 | Intron | XP_005255105.1 | |||
XM_005255049.3 | 1099 | Intron | XP_005255106.1 | |||
XM_017022874.1 | 1099 | Intron | XP_016878363.1 |