Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGTCCAGGGGGTGAACTCCTACGGA[A/G]ATATTCAAAGGACTCTTTTCCTCGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 153370 | ||||||||||||||||||||
Literature Links: |
ITGAL PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ITGAL - integrin subunit alpha L | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZNF747 - zinc finger protein 747 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZNF768 - zinc finger protein 768 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_024671.3 | 565 | Silent Mutation | NP_078947.3 | |||
XM_017023665.1 | 565 | Silent Mutation | XP_016879154.1 | |||
XM_017023666.1 | 565 | Silent Mutation | XP_016879155.1 |