Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCCCTGTTCCTCTGGTACTGCTACC[G/T]CCTGGGCTCCCAAGACATGCAGGCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 608947 MIM: 616667 | ||||||||||||||||||||
Literature Links: |
ASPHD1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ASPHD1 - aspartate beta-hydroxylase domain containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_181718.3 | 436 | Missense Mutation | CGC,CTC | R,L 97 | NP_859069.2 | |
XM_017023107.1 | 436 | Intron | XP_016878596.1 |
KCTD13 - potassium channel tetramerization domain containing 13 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SEZ6L2 - seizure related 6 homolog like 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |