Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGCAGGACGCTGCCACGGCCACCCT[A/G]CTCCAGGCAGTCCACACACTCCTCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 138970 MIM: 607000 | ||||||||||||||||||||
Literature Links: |
CSF3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CSF3 - colony stimulating factor 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MED24 - mediator complex subunit 24 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001079518.1 | 2992 | Nonsense Mutation | CAG,TAG | Q,* 924 | NP_001072986.1 | |
NM_001267797.1 | 2992 | Nonsense Mutation | CAG,TAG | Q,* 924 | NP_001254726.1 | |
NM_014815.3 | 2992 | Nonsense Mutation | CAG,TAG | Q,* 937 | NP_055630.2 | |
XM_005257874.2 | 2992 | Nonsense Mutation | CAG,TAG | Q,* 962 | XP_005257931.1 | |
XM_006722204.2 | 2992 | Nonsense Mutation | CAG,TAG | Q,* 1017 | XP_006722267.1 | |
XM_006722206.2 | 2992 | Nonsense Mutation | CAG,TAG | Q,* 992 | XP_006722269.1 | |
XM_006722207.2 | 2992 | Nonsense Mutation | CAG,TAG | Q,* 992 | XP_006722270.1 | |
XM_011525529.2 | 2992 | Nonsense Mutation | CAG,TAG | Q,* 1036 | XP_011523831.1 | |
XM_011525530.2 | 2992 | Nonsense Mutation | CAG,TAG | Q,* 999 | XP_011523832.1 | |
XM_011525531.2 | 2992 | Nonsense Mutation | CAG,TAG | Q,* 980 | XP_011523833.1 | |
XM_011525532.2 | 2992 | Nonsense Mutation | CAG,TAG | Q,* 1011 | XP_011523834.1 | |
XM_011525533.2 | 2992 | Nonsense Mutation | CAG,TAG | Q,* 1011 | XP_011523835.1 | |
XM_011525534.2 | 2992 | Nonsense Mutation | CAG,TAG | Q,* 968 | XP_011523836.1 | |
XM_011525535.2 | 2992 | Nonsense Mutation | CAG,TAG | Q,* 967 | XP_011523837.1 | |
XM_011525536.2 | 2992 | Nonsense Mutation | CAG,TAG | Q,* 956 | XP_011523838.1 | |
XM_011525538.2 | 2992 | Nonsense Mutation | CAG,TAG | Q,* 895 | XP_011523840.1 | |
XM_017025458.1 | 2992 | Nonsense Mutation | CAG,TAG | Q,* 999 | XP_016880947.1 | |
XM_017025459.1 | 2992 | Nonsense Mutation | CAG,TAG | Q,* 980 | XP_016880948.1 | |
XM_017025460.1 | 2992 | Nonsense Mutation | CAG,TAG | Q,* 956 | XP_016880949.1 | |
XM_017025461.1 | 2992 | Nonsense Mutation | CAG,TAG | Q,* 981 | XP_016880950.1 | |
XM_017025462.1 | 2992 | Nonsense Mutation | CAG,TAG | Q,* 955 | XP_016880951.1 | |
XM_017025463.1 | 2992 | Nonsense Mutation | CAG,TAG | Q,* 955 | XP_016880952.1 | |
XM_017025464.1 | 2992 | Nonsense Mutation | CAG,TAG | Q,* 949 | XP_016880953.1 | |
XM_017025465.1 | 2992 | Nonsense Mutation | CAG,TAG | Q,* 974 | XP_016880954.1 | |
XM_017025466.1 | 2992 | Nonsense Mutation | CAG,TAG | Q,* 937 | XP_016880955.1 | |
XM_017025467.1 | 2992 | Nonsense Mutation | CAG,TAG | Q,* 936 | XP_016880956.1 | |
XM_017025468.1 | 2992 | Nonsense Mutation | CAG,TAG | Q,* 936 | XP_016880957.1 | |
XM_017025469.1 | 2992 | Nonsense Mutation | CAG,TAG | Q,* 883 | XP_016880958.1 | |
XM_017025470.1 | 2992 | Nonsense Mutation | CAG,TAG | Q,* 840 | XP_016880959.1 | |
XM_017025471.1 | 2992 | Intron | XP_016880960.1 |
MIR6884 - microRNA 6884 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD124 - small nucleolar RNA, C/D box 124 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |