Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCTGCCTCCCCAGAAATCAAAGAGG[C/T]TGTCTCCTCACTCCCTTCATATTGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607763 MIM: 609848 | ||||||||||||||||||||
Literature Links: |
ACAP1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ACAP1 - ArfGAP with coiled-coil, ankyrin repeat and PH domains 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_014716.3 | 308 | Intron | NP_055531.1 |
KCTD11 - potassium channel tetramerization domain containing 11 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001002914.2 | 308 | Intron | NP_001002914.1 |
TMEM95 - transmembrane protein 95 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001320435.1 | 308 | Missense Mutation | GCT,GTT | A,V 80 | NP_001307364.1 | |
NM_001320436.1 | 308 | Missense Mutation | GCT,GTT | A,V 80 | NP_001307365.1 | |
NM_198154.2 | 308 | Missense Mutation | GCT,GTT | A,V 80 | NP_937797.1 | |
XM_017024565.1 | 308 | Missense Mutation | GCT,GTT | A,V 80 | XP_016880054.1 | |
XM_017024566.1 | 308 | Intron | XP_016880055.1 | |||
XM_017024567.1 | 308 | Intron | XP_016880056.1 | |||
XM_017024568.1 | 308 | Missense Mutation | GCT,GTT | A,V 80 | XP_016880057.1 | |
XM_017024569.1 | 308 | Missense Mutation | GCT,GTT | A,V 80 | XP_016880058.1 | |
XM_017024570.1 | 308 | Intron | XP_016880059.1 | |||
XM_017024571.1 | 308 | Missense Mutation | GCT,GTT | A,V 80 | XP_016880060.1 |