Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCGCCCATCATACTTGCTAGTAATG[A/G]GACCACAGGCTAGAGGGTACCAAGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611425 MIM: 604111 MIM: 610969 | ||||||||||||||||||||
Literature Links: |
CNTROB PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CNTROB - centrobin, centriole duplication and spindle assembly protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
KCNAB3 - potassium voltage-gated channel subfamily A regulatory beta subunit 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004732.3 | 819 | Missense Mutation | CCC,CTC | P,L 291 | NP_004723.2 | |
XM_011524068.1 | 819 | Missense Mutation | CCC,CTC | P,L 242 | XP_011522370.1 | |
XM_017025304.1 | 819 | Missense Mutation | CCC,CTC | P,L 242 | XP_016880793.1 | |
XM_017025305.1 | 819 | Missense Mutation | CCC,CTC | P,L 213 | XP_016880794.1 | |
XM_017025306.1 | 819 | Missense Mutation | CCC,CTC | P,L 213 | XP_016880795.1 |
LOC284023 - uncharacterized LOC284023 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TRAPPC1 - trafficking protein particle complex 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |