Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGAGCAGCGGCAGGGCGGGGTGCAG[A/C]AGTCGGGGCATGCTGGCCCTCCCTG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 609799 MIM: 610917 MIM: 602326 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
NARR PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
NARR - nine-amino acid residue-repeats | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NEK8 - NIMA related kinase 8 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RAB34 - RAB34, member RAS oncogene family | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPL23A - ribosomal protein L23a | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD42A - small nucleolar RNA, C/D box 42A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD42B - small nucleolar RNA, C/D box 42B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD4A - small nucleolar RNA, C/D box 4A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD4B - small nucleolar RNA, C/D box 4B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TLCD1 - TLC domain containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001160407.1 | 1570 | Intron | NP_001153879.1 | |||
NM_138463.3 | 1570 | Silent Mutation | CTG,CTT | L,L 4 | NP_612472.1 | |
XM_006721671.3 | 1570 | Intron | XP_006721734.1 | |||
XM_011524278.2 | 1570 | Silent Mutation | CTG,CTT | L,L 4 | XP_011522580.1 |