Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCACCCAGCACCTTCAAAGGGACAC[C/G]TACGGCAGAGAACCCAGAGTACCTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 164870 MIM: 601522 MIM: 611802 | ||||||||||||||||||||
Literature Links: |
ERBB2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ERBB2 - erb-b2 receptor tyrosine kinase 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001005862.2 | 4208 | Missense Mutation | CCT,CGT | P,R 1211 | NP_001005862.1 | |
NM_001289936.1 | 4208 | Missense Mutation | CCT,CGT | P,R 1226 | NP_001276865.1 | |
NM_001289937.1 | 4208 | UTR 3 | NP_001276866.1 | |||
NM_001289938.1 | 4208 | Intron | NP_001276867.1 | |||
NM_004448.3 | 4208 | Missense Mutation | CCT,CGT | P,R 1241 | NP_004439.2 |
GRB7 - growth factor receptor bound protein 7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIEN1 - migration and invasion enhancer 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_032339.4 | 4208 | Intron | NP_115715.3 | |||
XM_005257736.3 | 4208 | Intron | XP_005257793.1 |
MIR4728 - microRNA 4728 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |