Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCAGAGAGGGGTCGAAGGTCTTGTG[A/G]GGGTTCCTCAGCTGCTTCTTTTGCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 601934 MIM: 602578 | ||||||||||||||||||||
Literature Links: |
DUS1L PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DUS1L - dihydrouridine synthase 1 like | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_022156.4 | 1302 | Silent Mutation | CCC,CCT | P,P 380 | NP_071439.3 | |
XM_005256393.2 | 1302 | Silent Mutation | CCC,CCT | P,P 380 | XP_005256450.1 | |
XM_005256394.2 | 1302 | Silent Mutation | CCC,CCT | P,P 380 | XP_005256451.1 | |
XM_006722288.2 | 1302 | Silent Mutation | CCC,CCT | P,P 363 | XP_006722351.1 | |
XM_006722289.2 | 1302 | Silent Mutation | CCC,CCT | P,P 363 | XP_006722352.1 |
GPS1 - G protein pathway suppressor 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RFNG - RFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |