Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGCTAACCCCAGCACTGGAGCTGCT[C/G]TGACGCCGACTGCAACAGCCATTCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611577 | ||||||||||||||||||||
Literature Links: |
CYB5D1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CYB5D1 - cytochrome b5 domain containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
XM_005256440.3 | Intron | XP_005256497.1 | ||||
XM_011523638.2 | Intron | XP_011521940.1 |
KDM6B - lysine demethylase 6B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NAA38 - N(alpha)-acetyltransferase 38, NatC auxiliary subunit | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
XM_011524037.2 | Intron | XP_011522339.1 | ||||
XM_017025225.1 | Intron | XP_016880714.1 | ||||
XM_017025226.1 | Intron | XP_016880715.1 |
TMEM88 - transmembrane protein 88 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |