Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCAGCTCCTTTCGGAAGTGTTCATA[C/T]TGGAGCAGCTCTAACATGTGTAAAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 616967 | ||||||||||||||||||||
Literature Links: |
C17orf100 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C17orf100 - chromosome 17 open reading frame 100 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
KIAA0753 - KIAA0753 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MED31 - mediator complex subunit 31 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_016060.2 | 419 | Silent Mutation | CAA,CAG | Q,Q 80 | NP_057144.1 | |
XM_017024710.1 | 419 | UTR 3 | XP_016880199.1 |
TXNDC17 - thioredoxin domain containing 17 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_032731.3 | 419 | Intron | NP_116120.1 |