Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGCAGGGGTGTGTTGGAGACTTCTT[C/T]GATCTTCTTTTTAATAAACTCTGTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
SNHG25 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
SNHG25 - small nucleolar RNA host gene 25 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA50C - small nucleolar RNA, H/ACA box 50C | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD104 - small nucleolar RNA, C/D box 104 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TEX2 - testis expressed 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001288732.1 | 3185 | Missense Mutation | AAA,GAA | K,E 1014 | NP_001275661.1 | |
NM_001288733.1 | 3185 | Missense Mutation | AAA,GAA | K,E 1014 | NP_001275662.1 | |
NM_018469.4 | 3185 | Missense Mutation | AAA,GAA | K,E 1021 | NP_060939.3 | |
XM_011524998.1 | 3185 | Missense Mutation | AAA,GAA | K,E 1021 | XP_011523300.1 | |
XM_011524999.1 | 3185 | Missense Mutation | AAA,GAA | K,E 1021 | XP_011523301.1 | |
XM_011525000.1 | 3185 | Missense Mutation | AAA,GAA | K,E 1019 | XP_011523302.1 | |
XM_017024846.1 | 3185 | Missense Mutation | AAA,GAA | K,E 1012 | XP_016880335.1 | |
XM_017024847.1 | 3185 | Intron | XP_016880336.1 |