Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CACCTTCAAAGGGACACCTACGGCA[A/G]AGAACCCAGAGTACCTGGGTCTGGA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 164870 MIM: 601522 MIM: 611802 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ERBB2 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ERBB2 - erb-b2 receptor tyrosine kinase 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001005862.2 | 4216 | Missense Mutation | AAG,GAG | K,E 1214 | NP_001005862.1 | |
NM_001289936.1 | 4216 | Missense Mutation | AAG,GAG | K,E 1229 | NP_001276865.1 | |
NM_001289937.1 | 4216 | UTR 3 | NP_001276866.1 | |||
NM_001289938.1 | 4216 | Intron | NP_001276867.1 | |||
NM_004448.3 | 4216 | Missense Mutation | AAG,GAG | K,E 1244 | NP_004439.2 |
GRB7 - growth factor receptor bound protein 7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIEN1 - migration and invasion enhancer 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_032339.4 | 4216 | Intron | NP_115715.3 | |||
XM_005257736.3 | 4216 | Intron | XP_005257793.1 |
MIR4728 - microRNA 4728 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |