Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGCGTATTTCCCCCAGATCAGCAAC[A/G]CCACTGACCGCAAGTACCTGGTCAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603926 MIM: 188300 | ||||||||||||||||||||
Literature Links: |
C17orf99 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C17orf99 - chromosome 17 open reading frame 99 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SYNGR2 - synaptogyrin 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001320523.1 | 364 | Missense Mutation | ACC,GCC | T,A 98 | NP_001307452.1 | |
NM_004710.4 | 364 | Missense Mutation | ACC,GCC | T,A 98 | NP_004701.1 | |
XM_005257792.3 | 364 | Intron | XP_005257849.1 |
TK1 - thymidine kinase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |