Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGCCATCGGGTCAGGCGTTCAGGAA[C/T]GCGAAAGCTGACGGCTCTGAGCCAG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 613479 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CEP131 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CEP131 - centrosomal protein 131 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC105371925 - uncharacterized LOC105371925 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TEPSIN - TEPSIN, adaptor related protein complex 4 accessory protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_144679.2 | 2866 | Silent Mutation | NP_653280.1 | |||
XM_005257066.2 | 2866 | Silent Mutation | XP_005257123.1 | |||
XM_005257067.2 | 2866 | Silent Mutation | XP_005257124.1 | |||
XM_006721709.3 | 2866 | Silent Mutation | XP_006721772.1 | |||
XM_006721712.2 | 2866 | Silent Mutation | XP_006721775.1 | |||
XM_011524355.1 | 2866 | Silent Mutation | XP_011522657.1 | |||
XM_011524356.1 | 2866 | Silent Mutation | XP_011522658.1 | |||
XM_011524357.1 | 2866 | Silent Mutation | XP_011522659.1 | |||
XM_011524358.2 | 2866 | Silent Mutation | XP_011522660.1 | |||
XM_017024202.1 | 2866 | Silent Mutation | XP_016879691.1 | |||
XM_017024203.1 | 2866 | Silent Mutation | XP_016879692.1 | |||
XM_017024204.1 | 2866 | Silent Mutation | XP_016879693.1 |