Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGCACCCTCTGCTCTCCCGAAGCCC[A/C]GGCCCAGGCCAGCAGGGATACCTGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 602539 MIM: 608626 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
LIMD2 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
LIMD2 - LIM domain containing 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC729683 - uncharacterized LOC729683 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MAP3K3 - mitogen-activated protein kinase kinase kinase 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
STRADA - STE20-related kinase adaptor alpha | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001003786.2 | 1285 | Intron | NP_001003786.1 | |||
NM_001003787.2 | 1285 | Intron | NP_001003787.1 | |||
NM_001003788.2 | 1285 | Intron | NP_001003788.1 | |||
NM_001165969.1 | 1285 | Intron | NP_001159441.1 | |||
NM_001165970.1 | 1285 | Intron | NP_001159442.1 | |||
NM_153335.5 | 1285 | Silent Mutation | CCG,CCT | P,P 337 | NP_699166.2 | |
XM_005257797.2 | 1285 | Intron | XP_005257854.1 | |||
XM_005257798.2 | 1285 | Intron | XP_005257855.1 | |||
XM_005257799.2 | 1285 | Intron | XP_005257856.1 | |||
XM_005257800.2 | 1285 | Intron | XP_005257857.1 | |||
XM_005257801.4 | 1285 | Intron | XP_005257858.1 | |||
XM_005257803.4 | 1285 | Intron | XP_005257860.1 | |||
XM_011525466.2 | 1285 | Intron | XP_011523768.1 | |||
XM_011525467.2 | 1285 | Intron | XP_011523769.1 | |||
XM_017025312.1 | 1285 | Intron | XP_016880801.1 | |||
XM_017025313.1 | 1285 | Intron | XP_016880802.1 | |||
XM_017025314.1 | 1285 | Intron | XP_016880803.1 |