Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGCAAAGCCTTCCTCTTCAGAATGG[A/G]TGCCCTCACCCCGGGCAGGACTGTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
COPRS PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
COPRS - coordinator of PRMT5 and differentiation stimulator | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_018405.3 | 326 | Missense Mutation | ACC,ATC | T,I 73 | NP_060875.2 | |
XM_005258000.1 | 326 | Missense Mutation | ACC,ATC | T,I 61 | XP_005258057.1 |
UTP6 - UTP6, small subunit processome component | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |