Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCAGACTTCTCGGTTCCTCTTGGTG[A/T]CGAAGCTGCAGAGGCAGAATTAGAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 601392 MIM: 601394 | ||||||||||||||||||||
Literature Links: |
CCL14 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CCL14 - C-C motif chemokine ligand 14 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CCL15-CCL14 - CCL15-CCL14 readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CCL16 - C-C motif chemokine ligand 16 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004590.3 | 279 | Missense Mutation | GAC,GTC | D,V 68 | NP_004581.1 | |
XM_005258020.4 | 279 | Missense Mutation | GAC,GTC | D,V 68 | XP_005258077.1 |
LOC101927339 - uncharacterized LOC101927339 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |