Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAGAAGTTCAAAGTCATCCCCCTCA[C/G]CATCAGTGTCCAGGTCTGAACTGGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 616498 MIM: 602976 MIM: 608665 | ||||||||||||||||||||
Literature Links: |
FAM134C PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FAM134C - family with sequence similarity 134 member C | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_178126.3 | 1181 | Missense Mutation | GCT,GGT | A,G 442 | NP_835227.1 | |
XM_011524440.2 | 1181 | Missense Mutation | GCT,GGT | A,G 345 | XP_011522742.1 |
MLX - MLX, MAX dimerization protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PSMC3IP - PSMC3 interacting protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |