Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAGCAAGTCTTTTTGTTCCTGTGTG[A/C]CTTGTGAAGGAACTGCTGATGCCAG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 166945 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
LINC00854 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
LINC00854 - long intergenic non-protein coding RNA 854 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NBR1 - NBR1, autophagy cargo receptor | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM106A - transmembrane protein 106A | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001291586.1 | 424 | Missense Mutation | ACT,CCT | T,P 47 | NP_001278515.1 | |
NM_001291587.1 | 424 | Intron | NP_001278516.1 | |||
NM_001291588.1 | 424 | Missense Mutation | ACT,CCT | T,P 47 | NP_001278517.1 | |
NM_145041.3 | 424 | Missense Mutation | ACT,CCT | T,P 47 | NP_659478.1 | |
XM_006721658.2 | 424 | Missense Mutation | ACT,CCT | T,P 47 | XP_006721721.1 | |
XM_006721659.3 | 424 | Intron | XP_006721722.1 | |||
XM_011524260.1 | 424 | Missense Mutation | ACT,CCT | T,P 47 | XP_011522562.1 | |
XM_017024113.1 | 424 | Missense Mutation | ACT,CCT | T,P 47 | XP_016879602.1 | |
XM_017024114.1 | 424 | Intron | XP_016879603.1 |