Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGCAGTGTTTGATGTTTTCACATAC[C/G]CTCCTGTCTCAGGAAAACATTCAAG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||||||||||||||||||||
Literature Links: |
SNHG25 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
SNHG25 - small nucleolar RNA host gene 25 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA50C - small nucleolar RNA, H/ACA box 50C | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD104 - small nucleolar RNA, C/D box 104 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TEX2 - testis expressed 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001288732.1 | 4257 | UTR 3 | NP_001275661.1 | |||
NM_001288733.1 | 4257 | UTR 3 | NP_001275662.1 | |||
NM_018469.4 | 4257 | UTR 3 | NP_060939.3 | |||
XM_011524998.1 | 4257 | UTR 3 | XP_011523300.1 | |||
XM_011524999.1 | 4257 | UTR 3 | XP_011523301.1 | |||
XM_011525000.1 | 4257 | UTR 3 | XP_011523302.1 | |||
XM_017024846.1 | 4257 | UTR 3 | XP_016880335.1 | |||
XM_017024847.1 | 4257 | Intron | XP_016880336.1 |