Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGGTCATCTGCTACTGTTGCTTAAC[C/T]GAACCAAGATGATCCTTGCCATCTG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 602539 MIM: 608626 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
LIMD2 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
LIMD2 - LIM domain containing 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_030576.3 | 2371 | UTR 3 | NP_085053.1 | |||
XM_005257703.1 | 2371 | Intron | XP_005257760.1 | |||
XM_005257705.3 | 2371 | Intron | XP_005257762.1 | |||
XM_006722124.1 | 2371 | Intron | XP_006722187.1 |
LOC729683 - uncharacterized LOC729683 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MAP3K3 - mitogen-activated protein kinase kinase kinase 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_002401.3 | 2371 | Intron | NP_002392.2 | |||
NM_203351.1 | 2371 | Intron | NP_976226.1 | |||
XM_005257376.3 | 2371 | Intron | XP_005257433.1 | |||
XM_005257377.3 | 2371 | Intron | XP_005257434.1 | |||
XM_005257378.2 | 2371 | Intron | XP_005257435.1 |
STRADA - STE20-related kinase adaptor alpha | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |