Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CACATCTGGCTGTTCCAGCCACCAG[A/C]GAGAGCCCAAGACTGGTAACTGTCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604607 MIM: 609819 MIM: 610787 | ||||||||||||||||||||
Literature Links: |
HOXB13 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HOXB13 - homeobox B13 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006361.5 | 679 | Missense Mutation | GCT,TCT | A,S 175 | NP_006352.2 |
MIR3185 - microRNA 3185 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PRAC1 - prostate cancer susceptibility candidate 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PRAC2 - prostate cancer susceptibility candidate 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |