Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAGAATATTCTTTCTATCTTCTTCC[A/G]TCTGAAAGATTATAAAAAGTCCAGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 160730 MIM: 160740 | ||||||||||||||||||||
Literature Links: |
MYH1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MYH1 - myosin heavy chain 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MYH2 - myosin heavy chain 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001100112.1 | 5707 | Missense Mutation | ACG,ATG | T,M 1860 | NP_001093582.1 | |
NM_017534.5 | 5707 | Missense Mutation | ACG,ATG | T,M 1860 | NP_060004.3 |
MYHAS - myosin heavy chain gene cluster antisense RNA | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |