Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCACCAGTCCTCGCCAGGGGTAGCT[C/T]CTCCCGGGACAAGGACCGAAGTGCG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607264 MIM: 613939 | ||||||||||||||||||||
Literature Links: |
CACNA1G-AS1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CACNA1G-AS1 - CACNA1G antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
EPN3 - epsin 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC105371824 - uncharacterized LOC105371824 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SPATA20 - spermatogenesis associated 20 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001258372.1 | 206 | Missense Mutation | TCC,TTC | S,F 29 | NP_001245301.1 | |
NM_001258373.1 | 206 | UTR 5 | NP_001245302.1 | |||
NM_022827.3 | 206 | Missense Mutation | TCC,TTC | S,F 45 | NP_073738.2 |