Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTCCTACCTCAGTGCCCAGCGCCTC[A/G]AGTTCCGGCTGAACCTGTATGAGTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 600346 MIM: 603261 MIM: 602176 | ||||||||||||||||||||
Literature Links: |
LOC100287808 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC100287808 - uncharacterized LOC100287808 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCGF2 - polycomb group ring finger 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PIP4K2B - phosphatidylinositol-5-phosphate 4-kinase type 2 beta | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PSMB3 - proteasome subunit beta 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_002795.3 | 316 | Missense Mutation | AAG,GAG | K,E 68 | NP_002786.2 |