Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGATGGCACACAGGTTGGTATCTTC[A/G]AACAGACCCACCAGGTACGCTTCGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 601058 MIM: 616375 | ||||||||||||||||||||
Literature Links: |
H3F3B PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
H3F3B - H3 histone, family 3B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_005324.4 | 604 | Silent Mutation | NP_005315.1 |
MIR4738 - microRNA 4738 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
UNK - unkempt family zinc finger | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |