Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTCCCATCCAGTGCAGCCACAATTA[C/T]GGTCTTCCCGGCGTTGGCCATGGCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603926 MIM: 188300 | ||||||||||||||||||||
Literature Links: |
AFMID PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
AFMID - arylformamidase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
C17orf99 - chromosome 17 open reading frame 99 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SYNGR2 - synaptogyrin 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TK1 - thymidine kinase 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003258.4 | 569 | Missense Mutation | ATA,GTA | I,V 119 | NP_003249.3 | |
XM_017024992.1 | 569 | Missense Mutation | ATA,GTA | I,V 161 | XP_016880481.1 |