Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCAAGATGAATTTATCTGATATCA[C/T]GGTTTCTTAGGATATGGTTTATTTC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 603661 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
C18orf32 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
C18orf32 - chromosome 18 open reading frame 32 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC101928144 - uncharacterized LOC101928144 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR1539 - microRNA 1539 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPL17 - ribosomal protein L17 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000985.4 | Intron | NP_000976.1 | ||||
NM_001035006.2 | Intron | NP_001030178.1 | ||||
NM_001199340.1 | Intron | NP_001186269.1 | ||||
NM_001199341.1 | Intron | NP_001186270.1 | ||||
NM_001199342.1 | Intron | NP_001186271.1 | ||||
NM_001199343.1 | Intron | NP_001186272.1 | ||||
NM_001199344.1 | Intron | NP_001186273.1 | ||||
NM_001199345.1 | Intron | NP_001186274.1 |
RPL17-C18orf32 - RPL17-C18orf32 readthrough | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001199355.1 | Intron | NP_001186284.1 | ||||
NM_001199356.1 | Intron | NP_001186285.1 |
SNORD58A - small nucleolar RNA, C/D box 58A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD58B - small nucleolar RNA, C/D box 58B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD58C - small nucleolar RNA, C/D box 58C | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |