Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGGCACCAACACGCCCAGTTCCACC[A/G]TCTCGGTGAGTGTGGAAAGTAGGTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 612256 MIM: 609553 | ||||||||||||||||||||
Literature Links: |
MAST1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MAST1 - microtubule associated serine/threonine kinase 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_014975.2 | 450 | Missense Mutation | ATC,GTC | I,V 108 | NP_055790.1 | |
XM_011527805.2 | 450 | Missense Mutation | ATC,GTC | I,V 104 | XP_011526107.1 | |
XM_011527808.2 | 450 | Intron | XP_011526110.1 | |||
XM_017026501.1 | 450 | Intron | XP_016881990.1 |
MIR6794 - microRNA 6794 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RTBDN - retbindin | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |