Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGCTGCCAGCTCCTCACGGCTGTAC[A/C]CATCCGGGTAGTGAGAGGCCTCGAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604262 MIM: 600038 MIM: 611858 MIM: 610362 | ||||||||||||||||||||
Literature Links: |
APBA3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
APBA3 - amyloid beta precursor protein binding family A member 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MATK - megakaryocyte-associated tyrosine kinase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MRPL54 - mitochondrial ribosomal protein L54 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RAX2 - retina and anterior neural fold homeobox 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001319074.1 | 229 | Missense Mutation | GGG,GTG | G,V 100 | NP_001306003.1 | |
NM_032753.3 | 229 | Missense Mutation | GGG,GTG | G,V 54 | NP_116142.1 |