Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCAAGGCGGGCAGGTGGGAGCCATC[A/G]ATCTCGTGGTCCAGGAACTGGGCTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604999 MIM: 600327 | ||||||||||||||||||||
Literature Links: |
C19orf81 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C19orf81 - chromosome 19 open reading frame 81 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SHANK1 - SH3 and multiple ankyrin repeat domains 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_016148.3 | 6391 | Silent Mutation | ATC,ATT | I,I 2124 | NP_057232.2 | |
XM_006723233.3 | 6391 | Silent Mutation | ATC,ATT | I,I 2124 | XP_006723296.1 | |
XM_011527013.2 | 6391 | Silent Mutation | ATC,ATT | I,I 2132 | XP_011525315.1 | |
XM_011527014.2 | 6391 | Silent Mutation | ATC,ATT | I,I 2115 | XP_011525316.1 |
SYT3 - synaptotagmin 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |