Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCGCGAGTTGTAGGCGCGAGACAC[A/G]GTGTTCCAGGCGTCCATGTAGCGGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 150341 MIM: 607383 MIM: 610477 | ||||||||||||||||||||
Literature Links: |
LMNB2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LMNB2 - lamin B2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR7108 - microRNA 7108 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TIMM13 - translocase of inner mitochondrial membrane 13 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_012458.3 | 620 | Silent Mutation | ACC,ACT | T,T 79 | NP_036590.1 |
TMPRSS9 - transmembrane protease, serine 9 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
XM_011527978.2 | 620 | Intron | XP_011526280.1 | |||
XM_011527980.1 | 620 | Intron | XP_011526282.1 | |||
XM_011527982.2 | 620 | Intron | XP_011526284.1 |