Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGGATGCTTAGGGTGCGGGCTCCAG[C/T]AGGGGAGCACCTTGGCCCTGGTCTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 612082 MIM: 603074 | ||||||||||||||||||||
Literature Links: |
CIC PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CIC - capicua transcriptional repressor | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PAFAH1B3 - platelet activating factor acetylhydrolase 1b catalytic subunit 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001145939.1 | 1013 | Silent Mutation | CTA,CTG | L,L 226 | NP_001139411.1 | |
NM_001145940.1 | 1013 | Silent Mutation | CTA,CTG | L,L 226 | NP_001139412.1 | |
NM_002573.3 | 1013 | Silent Mutation | CTA,CTG | L,L 226 | NP_002564.1 | |
XM_017026846.1 | 1013 | Silent Mutation | CTA,CTG | L,L 213 | XP_016882335.1 | |
XM_017026847.1 | 1013 | Silent Mutation | CTA,CTG | L,L 213 | XP_016882336.1 | |
XM_017026848.1 | 1013 | Silent Mutation | CTA,CTG | L,L 213 | XP_016882337.1 |
PRR19 - proline rich 19 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |