Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCAAGGTTCTGATAAGAACCCAGGG[G/T]AGGAGAAAGCCGAGGAAGAGGGAGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607769 MIM: 611048 MIM: 602309 | ||||||||||||||||||||
Literature Links: |
PLEKHA4 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
PLEKHA4 - pleckstrin homology domain containing A4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PPP1R15A - protein phosphatase 1 regulatory subunit 15A | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_014330.3 | 747 | Missense Mutation | GAG,TAG | E,* 160 | NP_055145.3 |
TULP2 - tubby like protein 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |