Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTGTCTCCGGATGCCCCGCGCCTCG[C/T]TGCTCCCCGGCTCTTGGAAGTTGGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 147840 MIM: 614088 MIM: 601852 | ||||||||||||||||||||
Literature Links: |
ICAM1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ICAM1 - intercellular adhesion molecule 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ICAM4 - intercellular adhesion molecule 4 (Landsteiner-Wiener blood group) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ICAM5 - intercellular adhesion molecule 5 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003259.3 | 766 | Missense Mutation | GCT,GTT | A,V 234 | NP_003250.3 | |
XM_011528229.1 | 766 | Missense Mutation | GCT,GTT | A,V 234 | XP_011526531.1 | |
XM_017027185.1 | 766 | Intron | XP_016882674.1 |