Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTCCCTGAACCTCTCCCTGCAACAG[G/T]AGTACACAGGTGGGTAAGGGAGGGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604410 MIM: 605640 | ||||||||||||||||||||
Literature Links: |
LOC101928517 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC101928517 - uncharacterized LOC101928517 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SIGLEC7 - sialic acid binding Ig like lectin 7 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001277201.1 | 1087 | Intron | NP_001264130.1 | |||
NM_014385.3 | 1087 | Nonsense Mutation | GAG,TAG | E,* 340 | NP_055200.1 | |
NM_016543.3 | 1087 | Nonsense Mutation | GAG,TAG | E,* 247 | NP_057627.2 | |
XM_011526721.2 | 1087 | Nonsense Mutation | GAG,TAG | E,* 231 | XP_011525023.1 |
SIGLEC9 - sialic acid binding Ig like lectin 9 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |