Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGTACTGCGTGATCTGCGTGAGCCC[A/G]CATACGCCCGCGGCGATGGCAAAGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 610391 MIM: 600693 | ||||||||||||||||||||
Literature Links: |
MIR3187 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MIR3187 - microRNA 3187 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR4745 - microRNA 4745 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PLPPR3 - phospholipid phosphatase related 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001270366.1 | 1484 | Silent Mutation | TGC,TGT | C,C 248 | NP_001257295.1 | |
NM_024888.2 | 1484 | Silent Mutation | TGC,TGT | C,C 276 | NP_079164.1 | |
XM_011528317.2 | 1484 | Silent Mutation | TGC,TGT | C,C 276 | XP_011526619.1 |
PTBP1 - polypyrimidine tract binding protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |