Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGCAGGATGGTGGTGAGCTGCGGCC[A/G]CTGCAGAGTGAAGGCGCTGCAGCGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606424 MIM: 612945 | ||||||||||||||||||||
Literature Links: |
CYP2T1P PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CYP2T1P - cytochrome P450 family 2 subfamily T member 1, pseudogene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
EGLN2 - egl-9 family hypoxia inducible factor 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_053046.3 | 624 | Silent Mutation | CCA,CCG | P,P 90 | NP_444274.1 | |
NM_080732.3 | 624 | Silent Mutation | CCA,CCG | P,P 90 | NP_542770.2 |
MIA-RAB4B - MIA-RAB4B readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RAB4B - RAB4B, member RAS oncogene family | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RAB4B-EGLN2 - RAB4B-EGLN2 readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |