Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ATGGCAGCGGCATTGAAACCCATGA[C/T]GCGCATTTTGGTCCGCATCTCCAGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606580 MIM: 601703 | ||||||||||||||||||||
Literature Links: |
OPA3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
OPA3 - optic atrophy 3 (autosomal recessive, with chorea and spastic paraplegia) | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001017989.2 | 278 | Missense Mutation | ATC,GTC | I,V 60 | NP_001017989.2 | |
NM_025136.3 | 278 | Intron | NP_079412.1 | |||
XM_006723403.3 | 278 | Intron | XP_006723466.1 |
VASP - vasodilator-stimulated phosphoprotein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |