Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCGCCCCCAGGCCGCGTGCCCACGT[C/T]GTTCTCCACTCCCTACTCGGCGGCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 616658 MIM: 605490 | ||||||||||||||||||||
Literature Links: |
C19orf70 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C19orf70 - chromosome 19 open reading frame 70 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HSD11B1L - hydroxysteroid 11-beta dehydrogenase 1 like | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001267868.1 | 1039 | Missense Mutation | TCG,TTG | S,L 220 | NP_001254797.1 | |
NM_001267869.1 | 1039 | Missense Mutation | TCG,TTG | S,L 39 | NP_001254798.1 | |
NM_001267870.1 | 1039 | Silent Mutation | GTC,GTT | V,V 61 | NP_001254799.1 | |
NM_001267871.1 | 1039 | Missense Mutation | TCG,TTG | S,L 92 | NP_001254800.1 | |
NM_198533.2 | 1039 | Missense Mutation | TCG,TTG | S,L 173 | NP_940935.1 | |
NM_198704.2 | 1039 | Missense Mutation | TCG,TTG | S,L 39 | NP_941993.1 | |
NM_198705.2 | 1039 | Missense Mutation | TCG,TTG | S,L 92 | NP_941994.1 | |
NM_198706.2 | 1039 | Missense Mutation | TCG,TTG | S,L 173 | NP_941995.1 | |
NM_198707.2 | 1039 | Missense Mutation | TCG,TTG | S,L 86 | NP_941996.1 | |
NM_198708.2 | 1039 | Missense Mutation | TCG,TTG | S,L 39 | NP_941997.1 |
LOC107985320 - uncharacterized LOC107985320 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LONP1 - lon peptidase 1, mitochondrial | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPL36 - ribosomal protein L36 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |