Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGACTTCGGGGGATCTTGCTCTGGT[A/G]CCACTCTCGATTGTCCTCCAGCGTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 600128 MIM: 179490 | ||||||||||||||||||||
Literature Links: |
LOC102725254 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC102725254 - uncharacterized LOC102725254 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PDE4C - phosphodiesterase 4C | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
XM_011528056.2 | 1870 | Missense Mutation | CAC,TAC | H,Y 528 | XP_011526358.1 | |
XM_011528058.2 | 1870 | Missense Mutation | CAC,TAC | H,Y 403 | XP_011526360.1 | |
XM_017026866.1 | 1870 | Missense Mutation | CAC,TAC | H,Y 634 | XP_016882355.1 |
RAB3A - RAB3A, member RAS oncogene family | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |