Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAGCGCGTGCCCATGGGGCTGGTGA[C/G]CGAGATCTCCAGGTCTCCGCGCCGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 600487 MIM: 609346 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
C19orf25 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
C19orf25 - chromosome 19 open reading frame 25 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCSK4 - proprotein convertase subtilisin/kexin type 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_017573.4 | 1192 | Missense Mutation | CTC,GTC | L,V 510 | NP_060043.2 | |
XM_005259586.1 | 1192 | Missense Mutation | CTC,GTC | L,V 322 | XP_005259643.1 | |
XM_011528085.2 | 1192 | Missense Mutation | CTC,GTC | L,V 537 | XP_011526387.1 | |
XM_011528086.2 | 1192 | Missense Mutation | CTC,GTC | L,V 528 | XP_011526388.1 | |
XM_011528087.2 | 1192 | Missense Mutation | CTC,GTC | L,V 537 | XP_011526389.1 | |
XM_011528088.2 | 1192 | Missense Mutation | CTC,GTC | L,V 475 | XP_011526390.1 | |
XM_011528089.2 | 1192 | Missense Mutation | CTC,GTC | L,V 443 | XP_011526391.1 | |
XM_011528090.2 | 1192 | Missense Mutation | CTC,GTC | L,V 416 | XP_011526392.1 | |
XM_011528091.2 | 1192 | Missense Mutation | CTC,GTC | L,V 413 | XP_011526393.1 | |
XM_011528092.2 | 1192 | Missense Mutation | CTC,GTC | L,V 537 | XP_011526394.1 | |
XM_011528093.2 | 1192 | Missense Mutation | CTC,GTC | L,V 537 | XP_011526395.1 | |
XM_011528094.1 | 1192 | Missense Mutation | CTC,GTC | L,V 322 | XP_011526396.1 | |
XM_011528095.2 | 1192 | Missense Mutation | GCT,GGT | A,G 507 | XP_011526397.1 | |
XM_011528096.1 | 1192 | Missense Mutation | CTC,GTC | L,V 288 | XP_011526398.1 | |
XM_017026897.1 | 1192 | Missense Mutation | CTC,GTC | L,V 322 | XP_016882386.1 |
REEP6 - receptor accessory protein 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |