Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCTGGTACTCCTTGATGAAGGGATG[A/G]GACCTGTGGGCATCCTTCAGCTGGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606919 MIM: 606942 MIM: 602880 | ||||||||||||||||||||
Literature Links: |
CERS1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CERS1 - ceramide synthase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
COPE - coatomer protein complex subunit epsilon | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_007263.3 | 878 | Silent Mutation | TCC,TCT | S,S 283 | NP_009194.2 | |
NM_199442.1 | 878 | Silent Mutation | TCC,TCT | S,S 232 | NP_955474.1 | |
NM_199444.1 | 878 | Silent Mutation | TCC,TCT | S,S 231 | NP_955476.1 | |
XM_011527655.1 | 878 | Silent Mutation | TCC,TCT | S,S 306 | XP_011525957.1 | |
XM_011527656.1 | 878 | Silent Mutation | TCC,TCT | S,S 254 | XP_011525958.1 |
GDF1 - growth differentiation factor 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |